Skip to main navigation Skip to main content
  • E-Submission
  • Contact us

NS : Neurospine

OPEN ACCESS
ABOUT
BROWSE ARTICLES
FOR AUTHORS

Articles

Page Path

Original Article

STM2457 Inhibits METTL3-Mediated m6A Modification of miR-30c to Alleviate Spinal Cord Injury by Inducing the ATG5-Mediated Autophagy

Neurospine 2024;21(3):925-941.
Published online: September 30, 2024

Department of Orthopedics, Fujian Medical University Union Hospital, Fuzhou City, Fujian Province, China

Corresponding Author Wenge Liu Department of Orthopedics, Fujian Medical University Union Hospital, No. 29 Xinquan Road, Gulou District, Fuzhou City, Fujian Province 350001, China Email: wengeunion@fjmu.edu.cn
Co-corresponding Author Jiandong Li Department of Orthopedics, Fujian Medical University Union Hospital, No. 29 Xinquan Road, Gulou District, Fuzhou City, Fujian Province 350001, China Email: xiehelijiandong0591@fjmu.edu.cn

Gang Chen, Zhitao Shangguan contributed equally to this study as co-first authors.

• Received: May 7, 2024   • Revised: June 28, 2024   • Accepted: July 3, 2024

Copyright © 2024 by the Korean Spinal Neurosurgery Society

This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 7,049 Views
  • 100 Download
  • 16 Web of Science
  • 16 Crossref
  • 15 Scopus
prev next
  • Objective
    The study aimed to investigate the role of N6-methyladenosine (m6A) modification in spinal cord injury (SCI) and its underlying mechanism, focusing on the interplay between m6A methyltransferase-like 3 (METTL3), miR-30c, and autophagy-related proteins.
  • Methods
    An SCI model was established in rats, and changes in autophagy-related proteins, m6A methylation levels, and miR-30c levels were analyzed. Hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs) were used to assess the impact of METTL3 overexpression. The effects of STM2457, an antagonist of METTL3, were evaluated on cell viability, apoptosis, and autophagy markers in H2O2-stimulated SCNCs.
  • Results
    In the SCI model, decreased levels of autophagy markers and increased m6A methylation, miR-30c levels, and METTL3 were observed. Overexpression of METTL3 in SCNCs led to reduced cell viability, increased apoptosis, and suppressed autophagy. Conversely, co-overexpression of autophagy-related protein 5 (ATG5) or miR-30c inhibition reversed these effects. Knocking out METTL3 yielded opposite results. STM2457 treatment improved cell viability, reduced apoptosis, and upregulated autophagy markers in SCNCs, which also enhanced functional recovery in rats as measured by the Basso-Beattie-Bresnahan score and inclined plate test.
  • Conclusion
    STM2457 alleviated SCI by suppressing METTL3-mediated m6A modification of miR-30c, which in turn induces ATG5-mediated autophagy. This study provides insights into the role of m6A modification in SCI and suggests a potential therapeutic approach through targeting METTL3.
Spinal cord injury (SCI) is a common clinical central nervous system trauma disease that can cause sensory, motor and other neurological dysfunction below the injury level, and in severe cases, even life-threatening [1]. With the development of industrialization and mechanization, the incidence of SCI is increasing year by year, and due to its high disability and mortality rate, SCI brings a heavy burden to patients, families, and the society [2]. Among the many causes of SCI, traumatic factors are the most important damage factors, such as traffic accidents, violent attacks, falls, sports injuries, etc [3]. SCI can be divided into primary and secondary injuries based on the time of onset. The primary injury is caused by physical damage, while the secondary injury is induced by subsequent pathological processes such as inflammation and immunity. The secondary SCI can occur within 10 days after onset, including local hypoxia, ischemia, edema, oligodendrocyte demyelination, neuronal death, inflammatory cell infiltration, astrocyte proliferation, oxygen free radicals and toxic aggregates accumulation and vessel remodeling [4]. Among them, oxidative stress and inflammation are important factors inducing neuronal apoptosis and necrosis [5], which is not conducive to SCI recovery. Therefore, the current clinical treatment of SCI mainly focuses on reducing secondary injury. It is extremely important to find effective drugs for clinical SCI treatment [6]. Currently, methylprednisolone is the only drug for treating acute SCI. However, there is still controversy about the side effects and uncertainty of high-dose methylprednisolone shock therapy for treating acute SCI [7], Therefore, finding novel drugs and methods for SCI treatment has always been a research focus in the field of neuroscience.
Autophagy is a cell’s self-protection mechanism that degrades and recycles damaged organelles, toxic substances, and misfolded proteins through the autophagy-lysosome pathway, playing an important role in maintaining cell homeostasis [8,9]. Currently, the mechanism of increasing autophagy flux to protect nerves after trauma is not clear. Traumatic injury to the central nervous system can produce damaged cell components such as mitochondria, lysosomes, and peroxisomes, which are easily affected by oxidative stress and are also a source of oxidative stress [10]. In a mouse model of acute focal cerebral injury, reduced induction of autophagy flux leads to its functional deterioration, suggesting that enhancing autophagy flux is essential for the clearance of damaged cell components and offers neuroprotection by preventing further cellular damage [11,12]. The beneficial or harmful function of autophagy may depend on the induction or inhibition of autophagy flux after central nervous system injury. Normal autophagy flux usually leads to cell protection, while blocked autophagy flux usually leads to cell death [10]. LC3II/I and Beclin 1 are important biomarkers of autophagy and in the regulation of autophagy flux [13]. In our previous research, the expression of LC3II/I and Beclin 1 in spinal neurons of SCI rats was significantly downregulated, indicating that the downregulation of neuronal autophagy activity was closely related to the pathogenesis and progression of SCI [14]. Activating neuronal autophagy may become an important potential therapeutic strategy for SCI. it is reported that N6-methyladenosine (m6A) methylation is an important mechanism regulating miRNA and mRNA biogenesis [15], and it has been shown that m6A methylation participates in the pathogenesis of SCI [16]. However, the mechanism of m6A methylation that regulates neuronal autophagy in SCI pathological process remains to be further explored. Herein, the potential mechanisms of SCI through regulating miRNA expression by m6A methylation enzymes were investigated to explore novel treatment methods for SCI.
1. The Establishment of SCI Model in Rats Using the Modified Allen’s Method
Seven- to 9-week-old AD rats were purchased from Guangdong Animal Center. All rats were fasting from food and water for at least 4 hours before surgery. First, rats were anesthetized by intraperitoneal injection of 30-mg/kg sodium pentobarbital and then fixed in the prone position on the surgical table, and the surgical area on the back was prepared by using an electric razor. Iodine was used for routine disinfection, followed by laying sterile drapes. A midline incision was made from T10, with a length of about 3 cm, through the skin and subcutaneous tissue. Then, the bilateral paravertebral muscles were bluntly separated on the surface of the periosteum, and the bleeding was controlled by compression or electrocoagulation. The spinous processes and laminae of T9–11 were exposed. The spinous processes and laminae were gently fractured using bone forceps while maintaining the integrity of the dura mater. A SCI impactor weighing 10 g was used to impact the spinal cord at the T10 level from a height of 25 mm. The impactor was immediately removed to avoid rupture of the dura mater. The wound was then rinsed with normal saline, and the incision was closed layer by layer. After surgery, all rats were placed in separate cages and allowed to eat and drink. The temperature was maintained at 25°C. Manual compression of the bladder was performed twice a day to assist emptying of the bladder. In the sham group, the spinous processes and laminae of T9–11 were only exposed, without SCI operation.
Research experiments conducted in this article with animals were approved by the Ethical Committee of the Fujian Medical University (No. IACUC FJMU2023-0359).
2. The Isolation of SCNCs
Rats were euthanized, and the spinal cord was isolated and dissected. The dissected tissue was placed in a petri dish containing cold pH 7.2 D-Hank’s solution without calcium and magnesium. The tissue was then cut into approximately 1-mm3 tissue blocks using iris scissors. The tissue blocks were digested with trypsin for 10 minutes and the digestion was terminated by adding complete Dulbecco’s Modified Eagle Medium. Cells were then centrifuged and resuspended, filtered through a 200-mesh filter, and the obtained SCNCs were cultured in a CO2 incubator at 37°C.
3. The Construction of H2O2-Induced Injury Model in SCNCs and Investigations on the Role of METTL3 in H2O2-Induced Injury Model in SCNCs
To establish the invitro injury in SCNCs, cells were stimulated with 200 μM H2O2 for 24 hours. To explore the role of METTL3 in H2O2-induced injury model in SCNCs, METTL3-overexpressed (METTL3 OE) and METTL3-knockout (METTL3 KO) SCNCs were constructed, followed by stimulated with H2O2 for 24 hours.
4. Rescue Study
To confirm the regulatory function of METTL3 in H2O2-treated SCNCs, cells were transfected with the adenovirus containing pcDNA3.1-METTL3 and pcDNA3.1-ATG5 (H2O2+METTL3 OE+ATG5 OE) or the adenovirus containing pcDNA3.1-METTL3 and the miR-30c inhibitor (H2O2+METTL3 OE+miR-30c inh) for 48 hours, followed by stimulated with 200 μM H2O2 for 24 hours. Negative control (NC) was settled by transfecting SCNCs with EV and the inhibitor NC. The sequence of the miR-30c inh was 5´-GCUGAGAGUGUAGGAUGUUUACA-3´. The sequence of the inhibitor NC was 5´-CAGUACUUUUGUGUAGUACAA-3´.
5. Investigations on STM2457 in In Vitro and In Vivo Studies
To screen optimized concentrations of STM2457, SCNCs were treated with 0, 2, 4, 8, 16, 32, 64, and 128 μM STM2457, respectively. To explore the effects of STM2457 on the H2O2-induced injury in SCNCs, SCNCs were stimulated with H2O2 for 24 hours followed by treated with 16 and 32 μM STM2457, respectively. To check the protective function of STM2457 on SCI, sham, or SCI rats were intraperitoneal injected with 50 mg/kg STM2457 or normal saline (the same volume) for 2 weeks.
6. RNA Extraction and cDNA Synthesis
RNA was consistently extracted from spinal cord tissues using Trizol reagent (Invitrogen, Waltham, MA, USA) for all assays.
7. Reverse Transcription-Polymerase Chain Reaction Assay
RNA samples were reverse transcribed into cDNA using the reverse transcription kit (Vazyme, Nanjing, China). Subsequently, the polymerase chain reaction (PCR) was performed with the SYBR qPCR Mix kit (GenStar, Fuzhou, China). Gene expression levels were quantified using the 2−ΔΔCt method, with primer sequences detailed in Table 1. GAPDH served as an endogenous control for mRNA levels of autophagy-related genes (ATG5, ATG7, LC3, Beclin 1) and METTL family members (METTL3, METTL14, WTAP, KIAA1429), while U6 was used for miRNAs (miR-30c, miR-567, miR-183, miR-149, miR-214).
8. Total m6A Methylation Level Detection
The total m6A methylation level was measured using the EpiQuikTM m6A RNA Methylation Quantification kit (Epigentek, Farmingdale, NY, USA), starting with 200 ng of the previously extracted total RNA, following the manufacturer’s instructions.
9. MeRIP-qPCR Assay
mRNA was purified from the total RNA using the PolyATtract mRNA purification kit, followed by fragmentation. The fragmented RNA was subjected to immunoprecipitation with magnetic beads conjugated with m6A antibody or control IgG antibody at 4°C overnight. After washing, quantitative reverse transcription-PCR (qRT-PCR) analysis was conducted to assess the enrichment of m6A methylation.
10. RNA Pull Down and qRT-PCR
The RNA pull down was performed using an RNA pull down kit (Thermo Fisher, Waltham, MA, USA) to capture m6A-methylated RNA species. The enriched RNA was then extracted using Trizol and analyzed by qRT-PCR to determine the expression levels of ATG5 or miR-30c.
11. The Construction of METTL3 OE and METTL3 KO SCNCs
We constructed a METTL3 overexpression plasmid (pcDNA3.1-METTL3) and a METTL3 targeting siRNA (si-METTL3) for the generation of METTL3 OE and METTL3 KO SCNCs. The transfection was performed using an adenoviral vector for 48 hours, with an empty plasmid (empty vector, EV) and a nontargeting siRNA (si-NC) serving as NCs. The siRNA sequences were as follows: si-METTL3 (sense: 5´-GCUACCGUAUGGG ACAUUATT-3´ and antisense: 5´-UAAUGUCCCAUACGGUA GCTT-3´); si-NC (sense: 5´-GCGACGAUCUGCCUAAGAU TT-3´ and antisense: 5´-AUCUUAGGCAGAUCGUCGCTT-3´). To ensure the efficiency and specificity of the transfection, we assessed the transfection efficiency by monitoring the green fluorescent protein expression in the adenoviral vector and verified the knockdown or overexpression of METTL3 at both the mRNA and protein levels using Western blot analysis. The efficiency of siRNA-mediated knockdown was confirmed with a knockdown efficiency of over 70% as determined by quantitative analysis of the band intensities normalized to the GAPDH loading control.
12. Cell Counting Kit-8 Assay
Cells were implanted in a 96-well plate, and Cell Counting Kit-8 solution was added at a ratio of 1:10 to each well. The plate was incubated in a culture incubator for 2 hours, and the absorbance was detected at 450 nm using a spectrophotometer (Molecular Devices, LLC, San Jose, CA, USA). The cell viability was calculated using the following formula: (absorbance of experimental wells–absorbance of blank wells)/(absorbance of control wells–absorbance of blank wells)×100%.
13. Flow Cytometry for Detecting the Apoptosis
After culturing cells in a 6-well plate for 24 hours, cells were digested with trypsin and resuspended in 500 μL of binding buffer. Then, 5 μL of Annexin V-FITC and 10 μL of propidium iodide double staining reagent were added to the cell suspension in sequence. The mixture was mixed well and incubated at room temperature in the dark for 15 minutes. The cell apoptosis was measured by flow cytometry (BD, Franklin Lakes, NJ, USA).
14. Flow Cytometry for Detecting the Reactive Oxygen Species Level
The 2´,7´-Dichlorofluorescin Diacetate (DCFH-DA) was diluted with serum-free culture medium at a ratio of 1:1,000, resulting in a final concentration of 10 μmol/L. One milliliter of diluted DCFH-DA was used to resuspend the cells, resulting in a cell concentration of 1×106/mL. Cells were incubated at 37°C and 5% CO2 in a cell culture incubator for 20 minutes, allowing the probe to fully contact the cells. Cells were washed with serum-free cell culture medium 3 times, collected, and resuspended with 500 μL phosphate-buffered saline (PBS) buffer. The fluorescence intensity was detected using a flow cytometer (BD). The reactive oxygen species (ROS) level in each group of cells was represented by the relative fluorescence intensity.
15. The Superoxide Dismutase Activity Detection
The superoxide dismutase (SOD) activity was determined using a total superoxide dismutase assay kit with WST-8 (Shanghai Yubo Biotechnology Co., Ltd., Shanghai, China). The culture medium was discarded, the cells were collected using a cell scraper, washed with precooled sterile PBS, and then homogenized on ice using a sonicator at a ratio of 500 μL of PBS (pH 7.8) per 106 cells. The homogenate was centrifuged at 4°C and 10,000 r/min for 10 minutes, and the supernatant was collected. The detection plate was added, and the absorbance at 560 nm was measured.
16. Transmission Electron Microscope
1×107 cells were taken and fixed with 2.5% glutaraldehyde at 4°C for more than 30 minutes, which were then fixed with 1% osmic acid for 1 hour, and gradiently dehydrated. Cells were immersed in acetone and epoxy resin 812 at a ratio of 1:1 at 40°C for 6 hours, immersed in pure epoxy resin at 40°C for 4 hours, embedded in an embedding plate, added embedding agent, placed in a polymerization embedding box for polymerization, and sliced with a microtome. The slices were then stained with uranyl acetate for 20 minutes in the dark, washed with doubledistilled water 3 times, stained with lead citrate in the dark for 15 minutes, washed to remove excess lead solution, air-dried, and observed and photographed under a transmission electron microscope (HITACHI, Tokyo, Japan).
17. Western Blotting
Spinal cord tissues or SCNCs were collected for the extraction of total proteins, which were quantified with the bicinchoninic acid method, followed by conducting the separation with the 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After transferring proteins to the polyvinylidene difluoride membrane, 5% skim milk was applied for blocking. The primary antibodies against METTL3 (1:1,000), ATG5 (1:800), ATG7 (1:800), LC3II (1:1,000), LC3I (1:1,000), Beclin 1 (1:1,000), and GAPDH (1:2,000, CST, USA) were added, followed by incubation with the secondary antibody (1:2,000, CST, USA). After 60-minute incubation, the enhanced chemiluminescence solution was added for exposure and the expression level was quantified with the ImageJ software (National Institute Health, Bethesda, MD, USA).
18. Basso-Beattie-Bresnahan Behavioral Score
On the 14th day post SCI modeling, 2 experimenters who were unaware of the group allocation performed Basso-Beattie-Bresnahan (BBB) scoring on the motor function of the hind limbs of all experimental rats. The BBB scoring system (ranging from 0 to 21 points) evaluated joint movement, gait, hind limb coordination, and fine motor skills of rats during a 5-minute period of free movement in an open field. The higher the score, the better the motor function of the rats.
Inclined plate test: On the 14th day after surgery, 2 experimenters who were unaware of the group allocation performed the inclined plane test on the motor function of the hind limbs of all experimental rats. The inclined plane test recorded the maximum angle that rats could maintain within 5 seconds. The larger the inclined angle of the inclined plane, the better the motor function of the rats.
19. Nissl Staining Assay
After rats were anesthetized, 4% paraformaldehyde was used for cardiac perfusion. After successful perfusion, the skin, subcutaneous tissue, and muscle were cut open, and the spinal cord including the lesion (about 10 mm) was removed and fixed with 4% paraformaldehyde for 24 hours. Then, these specimens were paraffin-embedded and underwent continuous slicing (thickness of about 4 μm). After routine deparaffinization to water, 3 slices were made at the head and tail side of the lesion center (5 mm away from the center) for Nissl staining. The slices were incubated with 1% toluidine blue for 30 minutes (60°C), and washed with PBS 3 times, followed by gradient alcohol dehydration, transparent with xylene, and sealed with neutral resin. Positive cells were observed and counted under a microscope. Five random areas of each slice were counted, and the average retention of motor neurons in each group was calculated.
20. Statistical Analysis
Data are presented as the mean±standard deviation and were analyzed using GraphPad Prism ver. 8.0 (GraphPad Software Inc., La Jolla, CA, USA) for statistical significance. For comparisons between 2 groups, the unpaired Student t-test was employed to determine differences. When comparing 3 or more groups, 1-way analysis of variance was applied, followed by post hoc Tukey honestly significant difference test to identify the specific groups showing significant differences. A p-value of <0.05 or <0.01 was considered statistically significant.
1. Autophagy Was Repressed, ATG5 and miR-30c Were Downregulated, and METTL3-Mediated miR-30c m6A Methylation Was Enhanced in SCI Rats
Firstly, the autophagy state in SCI rats was evaluated. ATG5, ATG7, LC3, and Beclin 1 were found markedly downregulated in the spinal cord of SCI rats (Fig. 1A). Interestingly, in spinal cord tissues of SCI rats, the relative total m6A methylation level was sharply increased (Fig. 1B). As the expression difference of ATG5 between sham and SCI rats was the largest among ATG5, ATG7, LC3, and Beclin 1, the m6A level of ATG5 was determined. However, we found that the relative ATG5 m6A level in the spinal cord of SCI rats was only slightly changed, with no significant difference (Fig. 1C). It is reported that ATG5 was targeted by several miRNAs, including miR-30c [17], miR-567 [18], miR-183 [19], miR-149 [20], and miR-214 [21]. The level of these miRNAs was further checked. We found that in spinal cord tissues of SCI rats, only the relative miR-30c level was markedly increased, with levels of miR-567, miR-183, miR-149, and miR-214 minorly altered (Fig. 1D). Interestingly, it is previously reported that knocking down miR-30c protected against SCI through regulating SIRT1 [22]. Furthermore, the relative miR-30c m6A level in the spinal cord of SCI rats was sharply elevated (Fig. 1E), implying that the altered autophagy state in SCI rats might be correlated to the changed m6A methylation of miR-30c. Subsequently, the expression of main m6A methylases in spinal cord tissues was determined. In the spinal tissue of SCI rats, METTL3 was notably upregulated, with minorly changed levels of METTL14, WTAP, and KIAA1429.
2. METTL3 Facilitated the H2O2-Induced Injury and Repressed the H2O2-Induced Declined of Autophagy in SCNCs
To explore the role of METTL3 in SCI progression, METTL3 OE and METTL3 KO SCNCs were constructed, followed by stimulated with H2O2 for 24 hours. Firstly, the overexpression and knockdown of METTL3 in SCNCs were identified using the Western blotting assay (Fig. 2A). The cell viability was sharply repressed from 99.7% to 40.51% in H2O2-stimulated SCNCs, which was largely reduced to 9.22% and elevated to 67.17% in METTL3 OE and METTL3 KO SCNCs, respectively (Fig. 2B). Furthermore, the apoptotic rate in the control, H2O2, H2O2+ METTL3 OE, and H2O2+METTL3 KO groups was 6.44%, 41.89%, 66.9%, and 16.5%, respectively (Fig. 2C). The ROS level was sharply increased in H2O2-stimulated SCNCs, which was largely increased and reduced in METTL3 OE and METTL3 KO SCNCs, respectively (Fig. 2D). Moreover, the SOD activity in H2O2-stimulated SCNCs was declined from 6.40 U/mL to 3.12 U/mL, which was reduced to 2.13 U/mL in METTL3 OE SCNCs and elevated to 4.62 U/mL in METTL3 KO SCNCs, respectively (Fig. 2E). The number of autophagosome in H2O2-stimulated SCNCs was dramatically reduced, which was further decreased in METTL3 OE SCNCs and largely increased in METTL3 KO SCNCs (Fig. 2F). The levels of ATG5, ATG7, LC3 II/I, and Beclin 1 in H2O2-stimulated SCNCs were notably reduced, which were further repressed in METTL3 OE SCNCs and markedly increased in METTL3 KO SCNCs (Fig. 2G). Considering the important role of METTL3 in regulating the m6A methylation of target RNAs to mediate downstream protein expressions [23], we suspected that METTL3 might regulate autophagy in SCNCs through m6A methylation.
3. METTL3 Elevated miR-30c Level and the miR-30c m6A Methylation Level in H2O2-Stimulated SCNCs
In H2O2-stimulated SCNCs, the relative total m6A methylation level was sharply increased, which was further increased in METTL3 OE SCNCs and greatly reduced in METTL3 KO SCNCs (Fig. 3A). Furthermore, the METTL3 level was notably increased in H2O2-stimulated SCNCs, which was further elevated in METTL3 OE SCNCs and largely reduced in METTL3 KO SCNCs (Fig. 3B). The markedly increased miR-30c level observed in H2O2-stimulated SCNCs was sharply elevated in METTL3 OE SCNCs and largely repressed in METTL3 KO SCNCs (Fig. 3C). Moreover, the relative mR-30c m6A level in H2O2-stimulated SCNCs was markedly increased, which was remarkably further elevated in METTL3 OE SCNCs and largely reduced in METTL3 KO SCNCs (Fig. 3D). In the context of miR-30c, its methylation status may modulate the degradation or translational repression of its target mRNAs, thereby indirectly impacting autophagy-related genes. Given the established role of autophagy in maintaining cellular homeostasis [24] and the emerging link between miR-30c and autophagy, it was plausible that altered miR-30c methylation could disrupt the delicate balance of autophagic flux, potentially leading to impaired clearance of damaged cellular components and affecting cell viability.
4. METTL3 Aggravated the Injury and Suppressed the Autophagy in H2O2-Stimulated SCNCs by Downregulating ATG5 and Upregulating miR-30c
To explore the impact of METTL3 on the autophagy state in H2O2-stimulated SCNCs, METTL3 OE SCNCs were transfected with ATG5 overexpression (ATG5 OE) vector or the miR-30c inh, followed by stimulated with H2O2 for 24 hours. The declined cell viability observed in the H2O2 and H2O2+NC groups was markedly increased in the H2O2+METTL3 OE group, which was remarkably declined by the co-transfection of ATG5 OE and miR-30c inh (Fig. 4A). Moreover, the apoptotic rate in the control, H2O2, H2O2+NC, H2O2+METTL3 OE, H2O2+METTL3 OE+ATG5 OE, and H2O2+METTL3 OE+miR-30c inh groups was 4.86%, 43.95%, 44.04%, 68.73%, 60.42%, and 57.9%, respectively (Fig. 4B). In addition, the declined levels of ATG7, Beclin 1, and LC3 II/I observed in the H2O2 and H2O2+NC groups were notably reduced in the H2O2+METTL3 OE group, which were remarkably increased by the cotransfection of ATG5 OE and miR-30c inh (Fig. 4C).
5. METTL3 Suppressed the ATG5 Expression by Enhancing the m6A Methylation of miR-30c
ATG5 was sharply downregulated, while METTL3 was markedly downregulated in the H2O2 and H2O2+NC groups, which were further enhanced in the H2O2+METTL3 OE group. Compared to the H2O2+METTL3 OE group, the ATG5 level was markedly increased by the cotransfection of ATG5 OE and miR-30c inh, with the METTL3 level minorly changed (Fig. 5A). Moreover, the miR-30c level was sharply increased in the H2O2 and H2O2+NC groups, which was markedly increased in the H2O2+ METTL3 OE group. Compared to the H2O2+METTL3 OE group, the miR-30c level was largely reduced by the cotransfection of ATG5 OE, with minor change in the H2O2+METTL3 OE+ATG5 OE group (Fig. 5B). In addition, the increased relative miR-30c m6A level in H2O2-stimulated SCNCs and H2O2+ NC-stimulated SCNCs was largely enhanced in the H2O2+ METTL3 OE group, which was slightly altered in the H2O2+ METTL3 OE+ATG5 OE and H2O2+METTL3 OE+miR-30c inh groups (Fig. 5C). The interplay between METTL3 OE and the downregulation of ATG5, along with the concomitant increase in miR-30c levels, suggested a complex regulatory network in autophagy modulation. METTL3, known to mediate m6A methylation, could potentially influence the maturation or stability of miR-30c, thereby affecting its availability to bind target mRNAs. Given that miR-30c has been shown to target ATG5m [25], the observed increase in miR-30c levels upon METTL3 OE could lead to the degradation of ATG5 mRNA or inhibit its translation, resulting in reduced ATG5 protein levels. Such mechanism may be a key pathway through which METTL3 suppressed autophagy.
6. STM2457 Alleviated the Apoptosis and Declined Autophagy in H2O2-Stimulated SCNCs
STM2457, an antagonist of METTL3, was utilized to identify the role of METTL3 in H2O2-stimulated SCNCs. SCNCs were treated with 0, 2, 4, 8, 16, 32, 64, and 128 μM STM2457, respectively. When the concentration of STM2457 was lower than 32 μM, the cell viability was maintained around 100%, which was sharply reduced to 83.27% and 63.59% by 64 and 128 μM STM2457, respectively (Fig. 6A). Therefore, 16 and 32 μM STM2457 were applied in the subsequent experiments. SCNCs were stimulated with H2O2 for 24 hours, followed by treated with 16 and 32 μM STM2457, respectively. The cell viability was markedly reduced in H2O2-stimulated SCNCs, which was sharply elevated by 16 and 32 μM STM2457 (Fig. 6B). In addition, the apoptotic rate was largely increased from 4.60% to 46.43% in H2O2-stimulated SCNCs, which was markedly reduced to 36.32% and 15.99% by 16 and 32 μM STM2457, respectively (Fig. 6C). Moreover, levels of ATG5, ATG7, Beclin 1, and LC3 II/I were notably reduced in H2O2-stimulated SCNCs, which were remarkably elevated by 16 and 32 μM STM2457 (Fig. 6D). These findings underscored the need for further investigation into the safety, efficacy, and optimal dosing regimens of STM2457 in preclinical models. If proven successful, such therapeutics could transition into clinical trials, offering new hope for patients with SCI by providing a targeted approach to promote healing and improve long-term outcomes.
7. STM2457 Repressed the m6A Methylation of miR-30c
In H2O2-stimulated SCNCs, the relative total methylation level was markedly increase, which was largely reduced by 16 and 32 μM STM2457 (Fig. 7A). In addition, the markedly elevated miR-30c observed in H2O2-stimulated SCNCs was greatly repressed by 16 and 32 μM STM2457 (Fig. 7B). Furthermore, the relative miR-30c m6A level in H2O2-stimulated SCNCs was sharply increased, which was notably reduced by 16 and 32 μM STM2457 (Fig. 7C).
8. STM2457 Ameliorated the Pathological State and the Impaired Autophagy in the Spinal Cord Tissue of SCI Rats
To explore the potential therapeutic function of STM2457 on SCI, sham and SCI rats were administered with 50 mg/kg STM2457, respectively. The BBB score in the sham and STM2457 groups was maintained at 21 and was largely reduced to 6 in SCI rats. After the treatment of 50 mg/kg STM2457, the BBB score was recovered to 14.3 (Fig. 8A). Furthermore, in the inclined plate test, the maximum angle was maintained at 46.7° and 45.3° in the sham and STM2457 groups, respectively, which was largely reduced to 22.0° in SCI rats. After the treatment of 50 mg/kg STM2457, the maximum angle was reversed to 34.3° (Fig. 8B). The pathological changes in the spinal cord tissue were checked using the Nissl staining assay. The number of Nissl bodies in the sham, STM2457, SCI, and SCI+STM2457 groups was 31.3, 32.0, 7.7, and 15.3, respectively (Fig. 8C). Moreover, levels of ATG5, ATG7, Beclin 1, and LC3 II/I were slightly changed in the STM2457 group and markedly decreased in the SCI group, which were sharply elevated by the treatment of 50 mg/kg STM2457 (Fig. 8D). The compelling therapeutic effects of STM2457 in SCI rats underscored the translational potential of such METTL3 inhibitor. These findings suggested that STM2457 may enhance neurological recovery by promoting neuroprotection and supporting cellular repair mechanisms. The reduction in m6A methylation and miR-30c levels with STM2457 treatment was consistent with in vitro observations, indicating a possible mechanism of action that involved the modulation of the epitranscriptomic landscape. However, it is important to recognize the limitations of the current study. The relatively small sample size and the short-term follow-up period may not fully capture the long-term effects and safety profile of STM2457 treatment. Additionally, while the in vivo findings were promising, they need to be corroborated with further mechanistic studies to elucidate the precise pathways by which STM2457 exerted its neuroprotective effects. Future research should also address potential side effects, the optimal dosing regimen, and the scalability of these findings to human subjects. Rigorous preclinical studies, including dose-response analyses and long-term safety assessments, are warranted before considering the transition to clinical trials.
9. STM2457 Suppressed the m6A Methylation of miR-30c in the Spinal Cord Tissues of SCI Rats
Subsequently, the state of m6A methylation in the spinal cord tissues of rats was checked. The relative total m6A methylation level (Fig. 9A), miR-30c level (Fig. 9B), and the relative miR-30c m6A level (Fig. 9C) were minorly changed in the STM2457 group and largely increased in SCI rats, which were markedly reduced by 50 mg/kg STM2457.
In recent years, the role of autophagy in SCI has been increasingly receiving attentions [26]. Autophagy can be used to clear toxic ubiquitinated positive protein aggregates generated after injury, and also provides necessary components and energy for initiating the recovery process after injury [27]. Autophagy is a cell’s self-protection mechanism that degrades and recycles damaged organelles, toxic substances, and misfolded proteins through the autophagosome-lysosome pathway, playing an important role in maintaining cell homeostasis [8,9]. Zhou explored transcription factor E3 as a novel therapeutic target for SCI, demonstrating its capacity to enhance autophagy and mitigate endoplasmic reticulum stress, thereby promoting neural recovery [28]. Jiang revealed that cannabinoid receptor-2 reduced neuroinflammation after SCI by stimulating autophagy, which degraded the NOD-like receptor family pyrin domain-containing 3 inflammasome, highlighting a potential therapeutic strategy [29]. LC3 and Beclin 1 are commonly used to monitor the activity of cell autophagy in SCI [30]. LC3 can be divided into 3 isoforms: LC3A, LC3B, and LC3C. In experiments, LC3B is usually used as a marker of autophagy. There are 2 forms of proteolytic cleavage of LC3 protein: LC3I and LC3II. When autophagy occurs, LC3I undergoes ubiquitin-like modification and binds to phosphatidylethanolamine on the autophagosome vesicle membrane to form LC3II. Therefore, the ratio of LC3II/LC3I or the expression of LC3II is usually a direct indicator reflecting the number of autophagosomes [31,32]. The Beclin 1-Vps34-Vps15 core complex is required for autophagy precursor, and the expression of Beclin 1 is closely related to the activity of autophagosomes [33]. Herein, autophagy was found remarkably repressed in both H2O2-stimulated SCNCs and the spinal cord tissue of SCI rats, identified by Western blotting results on LC3II/I, Beclin 1, ATG5, and ATG7 levels and number of autophagosomes, which were in line with data presented by Liu et al. [34] and Wu et al. [35]
ATG5 is an important biomarker of autophagy and an 85% reduction of expression was observed in the spinal cord tissue of SCI rats, comparing to a 48% reduction of ATG7 expression, a 50% reduction of LC3 expression, and a 50% reduction of Beclin 1 expression. We suspected that the repressed autophagy in SCI might be correlated to the downregulation of ATG5. Numerous research results have confirmed that RNA methylation, particularly the m6A modification, is a critical post-transcriptional modification in the regulation of gene expression. The m6A modification is a reversible and dynamically regulated process, controlled by both the methyltransferase and demethylase complexes [36,37]. Recent studies have shed light on the intricate ways in which m6A methylation modulates the expression of autophagy-related genes [38,39]. While ATG5 is a well-studied gene influenced by m6A methylation [40], it is important to note that other autophagy-related genes are also subject to this epigenetic regulation, such as ATG7 [39] and Beclin 1 [41]. Herein, however, the increased ATG5 expression level was not accompanied by an altered m6A methylation of ATG5. As an important regulatory factor, miRNAs regulate approximately 30% of proteincoding genes and plays a critical regulatory role in life activities such as cell proliferation and differentiation, tissue growth, cell apoptosis, and signal transduction [42]. Recent studies have revealed several miRNAs that are involved in the regulation of ATG5 expression, such as miR-30c [17], miR-567 [18], miR-183 [19], miR-149 [20], and miR-214 [21]. We screened the expression of these 5 miRNAs and in the spinal cord tissue of SCI rats, levels of miR-567, miR-183, miR-149, and miR-214 were minorly changed, with a markedly boosted level of miR-30c, accompanied by an elevation of miR-30c m6A methylation level. We suspected that the inhibition of ATG5-mediated autophagy in SCI might be mediated by the m6A methylation of miR-30c and miR-30c might be a promising target for treating SCI in the clinic.
METTL3, METTL14, WTAP, and KIAA1429 are important m6A methyltransferases that are widely involved in the regulation of the expression of proteins [43]. Herein, we screened the expression of these 4 m6A methyltransferases in the spinal cord tissue of SCI rats, levels of METTL14, WTAP, and KIAA1429 were slightly altered, with a dramatically upregulated expression of METTL3, suggesting that the change of miR-30c m6A methylation might be mediated by the upregulation of METTL3. Furthermore, the declined autophagy and damage state in H2O2-stimulated SCNCs were markedly alleviated by the knockout of METTL3 and aggravated by the overexpression of METTL3, implying that METTL3 might be involved in the development of SCI by regulating the autophagy. Moreover, the expression and m6A methylation level of miR-30c were positive correlated with the expression of METTL3 in H2O2-stimulated SCNCs. We suspected that METTL3 might enhance the m6A methylation level of miR-30c to stabilize its expression, which targeted and silenced ATG5 to inhibiting autophagy, thus contributing to the SCI pathogenesis. As an antagonist of METTL3, STM2457 has been widely studied in multiple diseases to confirm the function of METTL3 and m6A methylation in these diseases [44-46]. Herein, a protective function of STM2457 against H2O2-induced injury in SCNCs and SCI-induced damages in rats were observed, which confirmed the involvement of METTL3 in the development of SCI. Furthermore, enhanced autophagy, upregulated TG5, declined miR-30c level, and reduced miR-30c m6A methylation level were observed in both H2O2-stimulated SCNCs and SCI rats following the administration of STM2457, suggesting that METTL3 facilitated the progression of SCI by inhibiting ATG5-mediated autophagy via enhancing the m6A methylation level of miR-30c. However, off-target effects are very critical for developing drugs. In our future work, to ensure the validity of our findings, we will conduct a comprehensive assessment to identify and mitigate potential offtarget effects of STM2457. Through rigorous experimental design and controls, we aim to rule out any unintended interactions that could confound our results. Specifically, we will employ a combination of in silico predictions, biochemical assays, and phenotypic screenings to identify and characterize any offtarget effects. Actually, the function of METTL3 in SCI has been revealed by Guo et al. [47] in the middle of 2023. The report of Guo et al. [47] claimed that in SCI, METTL3 might regulate the survival and apoptosis of neuronal cells by affecting the m6A modification levels of Bcl-2. Our research further confirmed the function and studied the potential mechanism of METTL3 in the progression of SCI regarding regulating autophagy.
There were some several limitations in the present study. Firstly, although the expression difference of ATG5 in the spinal cord tissues between sham and SCI rats was the highest, there were possibilities that the m6A methylation level of other autophagyrelated proteins, such as Beclin 1, ATG7, and LC3, was altered in SCI rats. In our future work, the alteration of m6A methylation of other autophagy-related proteins will be further studied. Secondly, miRNAs involved in the present study were referred to previous references, with the possibility that other key miRNAs were ignored. In our future work, a miRNA screening array will be applied to explore more differentially expressed miRNAs between sham and SCI rats. By integrating these advanced methodologies, our future research aims to provide a more nuanced view of the role of m6A methylation in autophagy and miRNA regulation, thereby contributing to a deeper comprehension of SCI’s molecular underpinnings and identifying potential therapeutic targets.
Collectively, STM2457 suppressed METTL3-mediated m6A modification of miR-30c to alleviate SCI by inducing the ATG5-mediated autophagy. STM2457 could be developed as a targeted therapeutic agent for SCI, with the potential to reduce secondary neuronal damage and promote functional recovery. The precise modulation of METTL3 activity or the m6A methylation status of miR-30c may offer a novel strategy to enhance neuroprotection and improve patient outcomes.
STM2457 alleviated SCI by suppressing METTL3-mediated m6A modification of miR-30c, which in turn induces ATG5-mediated autophagy. This study provides insights into the role of m6A modification in SCI and suggests a potential therapeutic approach through targeting METTL3.

Conflict of Interest

The authors have nothing to disclose.

Funding/Support

This work was supported by Fujian Provincial Natural Science Foundation of China (No. 2021J01762), and the Joint Funds for the innovation of science and Technology of Fujian province (2023Y9150, 2023Y9156).

Author Contribution

Conceptualization: JL, WL; Data curation: GC, ZS, XY, JL; Formal analysis: GC, ZS, XY, ZC, JL, WL; Funding acquisition: WL; Methodology: ZS, XY, ZC; Project administration: WL; Visualization: JL; Writing – original draft: GC; Writing – review & editing: WL.

Fig. 1.
Autophagy was repressed, ATG5 and miR-30c were downregulated, and METTL3-mediated miR-30c m6A methylation was enhanced in spinal cord injury (SCI) rats. (A) The levels of ATG5, ATG7, LC3, and Beclin 1 in the spinal cord tissues was detected using the reverse transcription-polymerase chain reaction (RT-PCR) assay. (B) The relative total m6A methylation level in the spinal cord tissues was determined using the m6A RNA Methylation Quantification kit. (C) The N6-methyladenosine (N6- m6A) level of ATG5 in the spinal cord tissues was determined by MeRIP-qPCR assay. (D) The levels of miR-30c, miR-567, miR-183, miR-149, and miR-214 in the spinal cord tissues were detected by the RT-PCR assay. (E) The m6A level of miR-30c in the spinal cord tissues was determined by MeRIP-qPCR assay. (F) The expression of METTL3, METTL14, WTAP, and KIAA1429 in the spinal cord tissues was detected using the RT-PCR assay. ATG5, autophagy-related protein 5; METTL3, methyltransferase- like 3; LC3, light chain 3. **p<0.01 vs. sham.
ns-2448494-247f1.jpg
Fig. 2.
The hydrogen peroxide (H2O2)-induced injury and repressed the H2O2-induced declined of autophagy in spinal cord neuron cells (SCNCs) were facilitated by METTL3 (**p<0.01 vs. control). METTL3 OE and METTL3 KO SCNCs were constructed, followed by stimulated with H2O2 for 24 hours. (A) The expression of METTL3 was determined by the Western blotting assay. (B) The cell viability was detected by the CCK-8 assay. (C) The apoptosis was determined by the flow cytometry. (D) The reactive oxygen species (ROS) level was determined using the flow cytometry. (E) The SOD activity was detected using the commercial kit. (F) The number of autophagosome was evaluated using the transmission electron microscope. (G) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. METTL3, methyltransferase-like 3; OE, overexpressed; KO, knockout; CCK-8, Cell Counting Kit-8; EV, Empty vector; APC-A, allophycocyanin-alexa fluor 750; NC, negative control; SOD, superoxide dismutase; ATG5, autophagy-related protein 5; LC3, light chain 3; ATG7, autophagy-related protein 7. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
ns-2448494-247f2.jpg
Fig. 3.
The miR-30c level and the miR-30c m6A methylation level in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs) were increased by METTL3. METTL3 OE and METTL3 KO SCNCs were constructed, followed by stimulated with H2O2 for 24 hours. (A) The relative total m6A methylation level was determined using the m6A RNA Methylation Quantification kit. (B) The expression of METTL3 was determined using the Western blotting assay. (C) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (D) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. METTL3, methyltransferase-like 3; OE, overexpressed; KO, knockout; ATG5, autophagy-related protein 5. **p<0.01 vs. control, ##p<0.01 vs. H2O2.
ns-2448494-247f3.jpg
Fig. 4.
METTL3 aggravated the injury and suppressed the autophagy in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs) by downregulating ATG5 and upregulating miR-30c. METTL3 OE SCNCs were transfected with ATG5 OE vector or the miR-30c inhibitor, followed by stimulated with H2O2 for 24 hours. (A) The cell viability was detected by the Cell Counting Kit-8 assay. (B) The apoptosis was determined by the flow cytometry. (C) The expression of ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. METTL3, methyltransferase-like 3; ATG5, autophagy-related protein 5; OE, overexpressed; NC, negative control; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. control, ##p<0.05 vs. H2O2+NC, &p<0.05 vs. H2O2+METTL3 OE, &&p<0.01 vs. H2O2+METTL3 OE.
ns-2448494-247f4.jpg
Fig. 5.
The ATG5 expression was repressed by METTL3 by enhancing the m6A methylation of miR-30c. METTL3 OE spinal cord neuron cells were transfected with ATG5 OE vector or the miR-30c inhibitor, followed by stimulated with hydrogen peroxide (H2O2) for 24 hours. (A) The expression of METTL3 and ATG5 was determined using the Western blotting assay. (B) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. METTL3, methyltransferase-like 3; ATG5, autophagy-related protein 5; OE, overexpressed; NC, negative control. **p<0.01 vs. control, ##p<0.05 vs. H2O2+NC, &p<0.05 vs. H2O2+METTL3 OE, &&p<0.01 vs. H2O2+METTL3 OE.
ns-2448494-247f5.jpg
Fig. 6.
STM2457 alleviated the apoptosis and declined autophagy in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs). (A) SCNCs were treated with 0, 2, 4, 8, 16, 32, 64, and 128 μM STM2457, respectively. The cell viability was detected using the CCK-8 assay (**p<0.01 vs. 0 μM). SCNCs were stimulated with hydrogen peroxide (H2O2) for 24 hours, followed by treated with 16 and 32 μM STM2457, respectively. (B) The cell viability was detected by the CCK-8 assay. (C) The apoptosis was determined by the flow cytometry. (D) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. CCK-8, Cell Counting Kit-8; ATG5, autophagy-related protein 5; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
ns-2448494-247f6.jpg
Fig. 7.
The m6A methylation and expression of miR-30c were repressed by STM2457. Spinal cord neuron cells were stimulated with hydrogen peroxide (H2O2) for 24 hours, followed by treated with 16 and 32 μM STM2457, respectively. (A) The relative total m6A methylation level was determined using the m6A RNA Methylation Quantification kit. (B) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. ATG5, autophagy-related protein 5. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
ns-2448494-247f7.jpg
Fig. 8.
STM2457 alleviated the pathological state and the impaired autophagy in the spinal cord tissue of spinal cord injury (SCI) rats. Sham and SCI rats were administered with 50 mg/kg STM2457, respectively. (A) The Basso-Beattie-Bresnahan (BBB) score was evaluated. (B) The maximum angle was recorded in the inclined plate test. (C) The pathological changes in the spinal cord tissue was checked using the Nissl staining assay. (D) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 in the spinal cord tissue was determined by the Western blotting assay. ATG5, autophagy-related protein 5; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. sham, #p<0.05 vs. SCI, ##p<0.01 vs. SCI.
ns-2448494-247f8.jpg
Fig. 9.
STM2457 suppressed the m6A methylation of miR-30c in the spinal cord tissues of spinal cord injury (SCI) rats. Sham and SCI rats were administered with 50 mg/kg STM2457, respectively. (A) The relative total m6A methylation level in the spinal cord tissue was determined using the m6A RNA Methylation Quantification kit. (B) The level of miR-30c in the spinal cord tissue was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 in the spinal cord tissue was determined by MeRIP-qPCR assay. ATG5, autophagy-related protein 5. **p<0.01 vs. sham, ##p<0.01 vs. SCI.
ns-2448494-247f9.jpg
Table 1.
Sequences of primers in the reverse transcription-polymerase chain reaction assay
Table 1.
Gene Forward primer (5´-3´) Reverse primer (5´-3´)
ATG5 TGAAGGAAGTTGTCTGGATAGCTCA AAGTCTGTCCTTCC GCAGTC
ATG7 GTGTACGATCCCTGTAACCTAACCC CGAAAGCAGAGAACTTCAACAGACT
LC3 AGCTCTGAAGGCAACAGCAACA GCTCCATGCAGGTAGCAGGAA
Beclin 1 CGTGGAGAAAGGCAAGATTGAAGA GTGAGGACACCCAAGCAAGACC
METTL3 ATGGGAAGGAACACTGCTTG ATGACTGGTGGAACGAACCT
METTL14 ATCGCCTCCTCCCAAATCTA ACCTCTGTGTGCTCCTCCAC
WTAP CTGACAAACGGACCAAGTAATG AAAGTCATCTTCGGTTGTGTTG
KIAA1429 GCAACTTCAGGCATTAAGTTCA GTATTGCCTTGTCGAATCTGTC
miR-30c TGTGTTTTTATTGTTTTTGTTGTCCCA GGGACAGAACAGGTTAATGGGAA
miR-567 AGGGAGTATGTTCTTCCAGGA GCGTTGTGTTGTGTTGTGTT
miR-183 GACTATGGCACTGGTAGAATTCA GCGTCGACTAGTACAACTCAAG
miR-149 GGCTCTGGCTCCGTGTCTT CAGTGCAGGGTCCGAGGTATT
miR-214 ATATCCGACAGCAGGCACAGACA AGTGCAGGGTCCGAGGTATT
U6 AAAGCAAATCATCGGACGACC GTACAACACATTGTTTCCTCGGA
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
  • 1. Anjum A, Yazid MD, Fauzi Daud M, et al. Spinal cord injury: pathophysiology, multimolecular interactions, and underlying recovery mechanisms. Int J Mol Sci 2020;21:7533.
  • 2. Bellucci CH, Castro Filho JE, Gomes CM, et al. Contemporary trends in the epidemiology of traumatic spinal cord injury: changes in age and etiology. Neuroepidemiology 2015;44:85-90.
  • 3. Li HL, Xu H, Li YL, et al. Epidemiology of traumatic spinal cord injury in Tianjin, China: an 18-year retrospective study of 735 cases. J Spinal Cord Med 2019;42:778-85.
  • 4. Eli I, Lerner DP, Ghogawala Z. Acute traumatic spinal cord injury. Neurol Clin 2021;39:471-88.
  • 5. Miguel CA, Noya-Riobo MV, Mazzone GL, et al. Antioxidant, anti-inflammatory and neuroprotective actions of resveratrol after experimental nervous system insults. Special focus on the molecular mechanisms involved. Neurochem Int 2021;150:105188.
  • 6. Oyinbo CA. Secondary injury mechanisms in traumatic spinal cord injury: a nugget of this multiply cascade. Acta Neurobiol Exp (Wars) 2011;71:281-99.
  • 7. Canseco JA, Karamian BA, Bowles DR, et al. Updated review: the steroid controversy for management of spinal cord injury. World Neurosurg 2021;150:1-8.
  • 8. Zhou K, Sansur CA, Xu H, et al. The temporal pattern, flux, and function of autophagy in spinal cord injury. Int J Mol Sci 2017;18:466.
  • 9. Kuma A, Komatsu M, Mizushima N. Autophagy-monitoring and autophagy-deficient mice. Autophagy 2017;13:1619-28.
  • 10. Lipinski MM, Wu J, Faden AI, et al. Function and mechanisms of autophagy in brain and spinal cord trauma. Antioxid Redox Signal 2015;23:565-77.
  • 11. Viscomi MT, D’Amelio M, Cavallucci V, et al. Stimulation of autophagy by rapamycin protects neurons from remote degeneration after acute focal brain damage. Autophagy 2012;8:222-35.
  • 12. Klionsky DJ, Abdalla FC, Abeliovich H, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 2012;8:445-544.
  • 13. Xiang H, Zhang J, Lin C, et al. Targeting autophagy-related protein kinases for potential therapeutic purpose. Acta Pharm Sin B 2020;10:569-81.
  • 14. Chen G, Li J, Wang Z, et al. Ezetimibe protects against spinal cord injury by regulating autophagy and apoptosis through inactivation of PI3K/AKT/mTOR signaling. Am J Transl Res 2020;12:2685-94.
  • 15. Alarcon CR, Lee H, Goodarzi H, et al. N6-methyladenosine marks primary microRNAs for processing. Nature 2015;519:482-5.
  • 16. Xing L, Cai Y, Yang T, et al. Epitranscriptomic m6A regulation following spinal cord injury. J Neurosci Res 2021;99:843-57.
  • 17. Zhang L, Chen X, Chang M, et al. MiR-30c-5p/ATG5 axis regulates the progression of Parkinson’s disease. Front Cell Neurosci 2021;15:644507.
  • 18. Han M, Hu J, Lu P, et al. Exosome-transmitted miR-567 reverses trastuzumab resistance by inhibiting ATG5 in breast cancer. Cell Death Dis 2020;11:43.
  • 19. Zheng S, Zhong YF, Tan DM, et al. miR-183-5p enhances the radioresistance of colorectal cancer by directly targeting ATG5. J Biosci 2019;44:92.
  • 20. Wei H, Li L, Zhang H, et al. Circ-FOXM1 knockdown suppresses non-small cell lung cancer development by regulating the miR-149-5p/ATG5 axis. Cell Cycle 2021;20:166-78.
  • 21. Zhou Y, Ge Y, Liu Q, et al. LncRNA BACE1-AS promotes autophagy-mediated neuronal damage through the miR-214-3p/ATG5 signalling axis in Alzheimer’s disease. Neuroscience 2021;455:52-64.
  • 22. Wang X, Su X, Gong F, et al. MicroRNA-30c abrogation protects against spinal cord ischemia reperfusion injury through modulating SIRT1. Eur J Pharmacol 2019;851:80-7.
  • 23. Zeng C, Huang W, Li Y, et al. Roles of METTL3 in cancer: mechanisms and therapeutic targeting. J Hematol Oncol 2020;13:117.
  • 24. Eskelinen EL. Autophagy: supporting cellular and organismal homeostasis by self-eating. Int J Biochem Cell Biol 2019;111:1-10.
  • 25. Wang X, Zhang Y, Han S, et al. Overexpression of miR‑30c‑5p reduces cellular cytotoxicity and inhibits the formation of kidney stones through ATG5. Int J Mol Med 2020;45:375-84.
  • 26. Yu D, Li M, Ni B, et al. Induction of neuronal mitophagy in acute spinal cord injury in rats. Neurotox Res 2013;24:512-22.
  • 27. Mizushima N, Levine B, Cuervo AM, et al. Autophagy fights disease through cellular self-digestion. Nature 2008;451:1069-75.
  • 28. Zhou K, Zheng Z, Li Y, et al. TFE3, a potential therapeutic target for Spinal Cord Injury via augmenting autophagy flux and alleviating ER stress. Theranostics 2020;10:9280-302.
  • 29. Jiang F, Xia M, Zhang Y, et al. Cannabinoid receptor-2 attenuates neuroinflammation by promoting autophagy-mediated degradation of the NLRP3 inflammasome post spinal cord injury. Front Immunol 2022;13:993168.
  • 30. Galluzzi L, Bravo-San Pedro JM, Blomgren K, et al. Autophagy in acute brain injury. Nat Rev Neurosci 2016;17:467-84.
  • 31. Mancias JD, Kimmelman AC. Mechanisms of selective autophagy in normal physiology and cancer. J Mol Biol 2016;428:1659-80.
  • 32. Schaaf MB, Keulers TG, Vooijs MA, et al. LC3/GABARAP family proteins: autophagy-(un)related functions. FASEB J 2016;30:3961-78.
  • 33. Lu N, Li X, Tan R, et al. HIF-1alpha/Beclin1-mediated autophagy is involved in neuroprotection induced by hypoxic preconditioning. J Mol Neurosci 2018;66:238-50.
  • 34. Liu X, Wu Y, Zhou D, et al. N‑linoleyltyrosine protects PC12 cells against oxidative damage via autophagy: possible involvement of CB1 receptor regulation. Int J Mol Med 2020;46:1827-37.
  • 35. Wu YQ, Xiong J, He ZL, et al. Metformin promotes microglial cells to facilitate myelin debris clearance and accelerate nerve repairment after spinal cord injury. Acta Pharmacol Sin 2022;43:1360-71.
  • 36. Zhang C, Liu N. N6-methyladenosine (m6A) modification in gynecological malignancies. J Cell Physiol 2022;237:3465-79.
  • 37. Sendinc E, Shi Y. RNA m6A methylation across the transcriptome. Mol Cell 2023;83:428-41.
  • 38. Chen X, Wang J, Tahir M, et al. Current insights into the implications of m6A RNA methylation and autophagy interaction in human diseases. Cell Biosci 2021;11:147.
  • 39. Chen X, Gong W, Shao X, et al. METTL3-mediated m(6)A modification of ATG7 regulates autophagy-GATA4 axis to promote cellular senescence and osteoarthritis progression. Ann Rheum Dis 2022;81:87-99.
  • 40. Wang X, Wu R, Liu Y, et al. m(6)A mRNA methylation controls autophagy and adipogenesis by targeting Atg5 and Atg7. Autophagy 2020;16:1221-35.
  • 41. He M, Lei H, He X, et al. METTL14 Regulates osteogenesis of bone marrow mesenchymal stem cells via inducing autophagy through m6A/IGF2BPs/beclin-1 signal axis. Stem Cells Transl Med 2022;11:987-1001.
  • 42. Budakoti M, Panwar AS, Molpa D, et al. Micro-RNA: the darkhorse of cancer. Cell Signal 2021;83:109995.
  • 43. Zhang N, Ding C, Zuo Y, et al. N6-methyladenosine and neurological diseases. Mol Neurobiol 2022;59:1925-37.
  • 44. Yankova E, Blackaby W, Albertella M, et al. Small-molecule inhibition of METTL3 as a strategy against myeloid leukaemia. Nature 2021;593:597-601.
  • 45. Wu X, Ye W, Gong Y. The Role of RNA methyltransferase METTL3 in normal and malignant hematopoiesis. Front Oncol 2022;12:873903.
  • 46. Sun Y, Shen W, Hu S, et al. METTL3 promotes chemoresistance in small cell lung cancer by inducing mitophagy. J Exp Clin Cancer Res 2023;42:65.
  • 47. Guo S, Lin T, Chen G, et al. METTL3 affects spinal cord neuronal apoptosis by regulating Bcl-2 m6A modifications after spinal cord injury. Neurospine 2023;20:623-36.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

STM2457 Inhibits METTL3-Mediated m6A Modification of miR-30c to Alleviate Spinal Cord Injury by Inducing the ATG5-Mediated Autophagy
Neurospine. 2024;21(3):925-941.   Published online September 30, 2024
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
STM2457 Inhibits METTL3-Mediated m6A Modification of miR-30c to Alleviate Spinal Cord Injury by Inducing the ATG5-Mediated Autophagy
Neurospine. 2024;21(3):925-941.   Published online September 30, 2024
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • 7
  • 8
STM2457 Inhibits METTL3-Mediated m6A Modification of miR-30c to Alleviate Spinal Cord Injury by Inducing the ATG5-Mediated Autophagy
Image Image Image Image Image Image Image Image Image
Fig. 1. Autophagy was repressed, ATG5 and miR-30c were downregulated, and METTL3-mediated miR-30c m6A methylation was enhanced in spinal cord injury (SCI) rats. (A) The levels of ATG5, ATG7, LC3, and Beclin 1 in the spinal cord tissues was detected using the reverse transcription-polymerase chain reaction (RT-PCR) assay. (B) The relative total m6A methylation level in the spinal cord tissues was determined using the m6A RNA Methylation Quantification kit. (C) The N6-methyladenosine (N6- m6A) level of ATG5 in the spinal cord tissues was determined by MeRIP-qPCR assay. (D) The levels of miR-30c, miR-567, miR-183, miR-149, and miR-214 in the spinal cord tissues were detected by the RT-PCR assay. (E) The m6A level of miR-30c in the spinal cord tissues was determined by MeRIP-qPCR assay. (F) The expression of METTL3, METTL14, WTAP, and KIAA1429 in the spinal cord tissues was detected using the RT-PCR assay. ATG5, autophagy-related protein 5; METTL3, methyltransferase- like 3; LC3, light chain 3. **p<0.01 vs. sham.
Fig. 2. The hydrogen peroxide (H2O2)-induced injury and repressed the H2O2-induced declined of autophagy in spinal cord neuron cells (SCNCs) were facilitated by METTL3 (**p<0.01 vs. control). METTL3 OE and METTL3 KO SCNCs were constructed, followed by stimulated with H2O2 for 24 hours. (A) The expression of METTL3 was determined by the Western blotting assay. (B) The cell viability was detected by the CCK-8 assay. (C) The apoptosis was determined by the flow cytometry. (D) The reactive oxygen species (ROS) level was determined using the flow cytometry. (E) The SOD activity was detected using the commercial kit. (F) The number of autophagosome was evaluated using the transmission electron microscope. (G) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. METTL3, methyltransferase-like 3; OE, overexpressed; KO, knockout; CCK-8, Cell Counting Kit-8; EV, Empty vector; APC-A, allophycocyanin-alexa fluor 750; NC, negative control; SOD, superoxide dismutase; ATG5, autophagy-related protein 5; LC3, light chain 3; ATG7, autophagy-related protein 7. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
Fig. 3. The miR-30c level and the miR-30c m6A methylation level in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs) were increased by METTL3. METTL3 OE and METTL3 KO SCNCs were constructed, followed by stimulated with H2O2 for 24 hours. (A) The relative total m6A methylation level was determined using the m6A RNA Methylation Quantification kit. (B) The expression of METTL3 was determined using the Western blotting assay. (C) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (D) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. METTL3, methyltransferase-like 3; OE, overexpressed; KO, knockout; ATG5, autophagy-related protein 5. **p<0.01 vs. control, ##p<0.01 vs. H2O2.
Fig. 4. METTL3 aggravated the injury and suppressed the autophagy in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs) by downregulating ATG5 and upregulating miR-30c. METTL3 OE SCNCs were transfected with ATG5 OE vector or the miR-30c inhibitor, followed by stimulated with H2O2 for 24 hours. (A) The cell viability was detected by the Cell Counting Kit-8 assay. (B) The apoptosis was determined by the flow cytometry. (C) The expression of ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. METTL3, methyltransferase-like 3; ATG5, autophagy-related protein 5; OE, overexpressed; NC, negative control; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. control, ##p<0.05 vs. H2O2+NC, &p<0.05 vs. H2O2+METTL3 OE, &&p<0.01 vs. H2O2+METTL3 OE.
Fig. 5. The ATG5 expression was repressed by METTL3 by enhancing the m6A methylation of miR-30c. METTL3 OE spinal cord neuron cells were transfected with ATG5 OE vector or the miR-30c inhibitor, followed by stimulated with hydrogen peroxide (H2O2) for 24 hours. (A) The expression of METTL3 and ATG5 was determined using the Western blotting assay. (B) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. METTL3, methyltransferase-like 3; ATG5, autophagy-related protein 5; OE, overexpressed; NC, negative control. **p<0.01 vs. control, ##p<0.05 vs. H2O2+NC, &p<0.05 vs. H2O2+METTL3 OE, &&p<0.01 vs. H2O2+METTL3 OE.
Fig. 6. STM2457 alleviated the apoptosis and declined autophagy in hydrogen peroxide (H2O2)-stimulated spinal cord neuron cells (SCNCs). (A) SCNCs were treated with 0, 2, 4, 8, 16, 32, 64, and 128 μM STM2457, respectively. The cell viability was detected using the CCK-8 assay (**p<0.01 vs. 0 μM). SCNCs were stimulated with hydrogen peroxide (H2O2) for 24 hours, followed by treated with 16 and 32 μM STM2457, respectively. (B) The cell viability was detected by the CCK-8 assay. (C) The apoptosis was determined by the flow cytometry. (D) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 was determined by the Western blotting assay. CCK-8, Cell Counting Kit-8; ATG5, autophagy-related protein 5; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
Fig. 7. The m6A methylation and expression of miR-30c were repressed by STM2457. Spinal cord neuron cells were stimulated with hydrogen peroxide (H2O2) for 24 hours, followed by treated with 16 and 32 μM STM2457, respectively. (A) The relative total m6A methylation level was determined using the m6A RNA Methylation Quantification kit. (B) The level of miR-30c was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 was determined by MeRIP-qPCR assay. ATG5, autophagy-related protein 5. **p<0.01 vs. control, #p<0.05 vs. H2O2, ##p<0.01 vs. H2O2.
Fig. 8. STM2457 alleviated the pathological state and the impaired autophagy in the spinal cord tissue of spinal cord injury (SCI) rats. Sham and SCI rats were administered with 50 mg/kg STM2457, respectively. (A) The Basso-Beattie-Bresnahan (BBB) score was evaluated. (B) The maximum angle was recorded in the inclined plate test. (C) The pathological changes in the spinal cord tissue was checked using the Nissl staining assay. (D) The expression of ATG5, ATG7, LC3 I, LC3 II, and Beclin 1 in the spinal cord tissue was determined by the Western blotting assay. ATG5, autophagy-related protein 5; ATG7, autophagy-related protein 7; LC3, light chain 3. **p<0.01 vs. sham, #p<0.05 vs. SCI, ##p<0.01 vs. SCI.
Fig. 9. STM2457 suppressed the m6A methylation of miR-30c in the spinal cord tissues of spinal cord injury (SCI) rats. Sham and SCI rats were administered with 50 mg/kg STM2457, respectively. (A) The relative total m6A methylation level in the spinal cord tissue was determined using the m6A RNA Methylation Quantification kit. (B) The level of miR-30c in the spinal cord tissue was detected using the reverse transcription-polymerase chain reaction assay. (C) The N6-methyladenosine (m6A) level of ATG5 in the spinal cord tissue was determined by MeRIP-qPCR assay. ATG5, autophagy-related protein 5. **p<0.01 vs. sham, ##p<0.01 vs. SCI.
STM2457 Inhibits METTL3-Mediated m6A Modification of miR-30c to Alleviate Spinal Cord Injury by Inducing the ATG5-Mediated Autophagy
Gene Forward primer (5´-3´) Reverse primer (5´-3´)
ATG5 TGAAGGAAGTTGTCTGGATAGCTCA AAGTCTGTCCTTCC GCAGTC
ATG7 GTGTACGATCCCTGTAACCTAACCC CGAAAGCAGAGAACTTCAACAGACT
LC3 AGCTCTGAAGGCAACAGCAACA GCTCCATGCAGGTAGCAGGAA
Beclin 1 CGTGGAGAAAGGCAAGATTGAAGA GTGAGGACACCCAAGCAAGACC
METTL3 ATGGGAAGGAACACTGCTTG ATGACTGGTGGAACGAACCT
METTL14 ATCGCCTCCTCCCAAATCTA ACCTCTGTGTGCTCCTCCAC
WTAP CTGACAAACGGACCAAGTAATG AAAGTCATCTTCGGTTGTGTTG
KIAA1429 GCAACTTCAGGCATTAAGTTCA GTATTGCCTTGTCGAATCTGTC
miR-30c TGTGTTTTTATTGTTTTTGTTGTCCCA GGGACAGAACAGGTTAATGGGAA
miR-567 AGGGAGTATGTTCTTCCAGGA GCGTTGTGTTGTGTTGTGTT
miR-183 GACTATGGCACTGGTAGAATTCA GCGTCGACTAGTACAACTCAAG
miR-149 GGCTCTGGCTCCGTGTCTT CAGTGCAGGGTCCGAGGTATT
miR-214 ATATCCGACAGCAGGCACAGACA AGTGCAGGGTCCGAGGTATT
U6 AAAGCAAATCATCGGACGACC GTACAACACATTGTTTCCTCGGA
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
Table 1. Sequences of primers in the reverse transcription-polymerase chain reaction assay